Bio::Tools::Run::StandUsereContributed)Bio::Tools::Run::StandAloneNCBIBlast(3)NAMEBio::Tools::Run::StandAloneNCBIBlast - Object for the local execution
of the NCBI BLAST program suite (blastall, blastpgp, bl2seq). With
experimental support for NCBI rpsblast.
SYNOPSIS
# Do not use directly; see Bio::Tools::Run::StandAloneBlast
DESCRIPTION
See Bio::Tools::Run::StandAloneBlast
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly address
it. Please include a thorough description of the problem with code and
data examples if at all possible.
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
http://bugzilla.open-bio.org/
AUTHOR - Peter Schattner
Email schattner at alum.mit.edu
MAINTAINER - Torsten Seemann
Email torsten at infotech.monash.edu.au
CONTRIBUTORS
Sendu Bala bix@sendu.me.uk (reimplementation)
APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
new
Title : new
Usage : my $obj = Bio::Tools::Run::StandAloneBlast->new();
Function: Builds a newBio::Tools::Run::StandAloneBlast object
Returns : Bio::Tools::Run::StandAloneBlast
Args : -quiet => boolean # make program execution quiet
-_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
# the parsing method, case insensitive
Essentially all BLAST parameters can be set via StandAloneBlast.pm.
Some of the most commonly used parameters are listed below. All
parameters have defaults and are optional except for -p in those
programs that have it. For a complete listing of settable parameters,
run the relevant executable BLAST program with the option "-" as in
blastall - Note that the input paramters (-i, -j, -input) should not be
set directly by you: this module sets them when you call one of the
executable methods.
Blastall
-p Program Name [String]
Input should be one of "blastp", "blastn", "blastx",
"tblastn", or "tblastx".
-d Database [String] default = nr
The database specified must first be formatted with formatdb.
Multiple database names (bracketed by quotations) will be accepted.
An example would be -d "nr est"
-e Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
-S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
Blastpgp (including Psiblast)
-j is the maximum number of rounds (default 1; i.e., regular BLAST)
-h is the e-value threshold for including sequences in the
score matrix model (default 0.001)
-c is the "constant" used in the pseudocount formula specified in the paper (default 10)
-B Multiple alignment file for PSI-BLAST "jump start mode" Optional
-Q Output File for PSI-BLAST Matrix in ASCII [File Out] Optional
rpsblast
-d Database [String] default = (none - you must specify a database)
The database specified must first be formatted with formatdb.
Multiple database names (bracketed by quotations) will be accepted.
An example would be -d "Cog Smart"
-e Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
Bl2seq
-p Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String]
default = blastp
-o alignment output file [File Out] default = stdout
-e Expectation value (E) [Real] default = 10.0
-S Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
blastall
Title : blastall
Usage : $blast_report = $factory->blastall('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->blastall($input);
or
$seq_array_ref = \@seq_array;
# where @seq_array is an array of Bio::Seq objects
$blast_report = $factory->blastall($seq_array_ref);
Returns : Reference to a Blast object containing the blast report.
Args : Name of a file or Bio::Seq object or an array of
Bio::Seq object containing the query sequence(s).
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
blastpgp
Title : blastpgp
Usage : $blast_report = $factory-> blastpgp('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
$blast_report = $factory->blastpgp ($input);
or
$seq_array_ref = \@seq_array;
# where @seq_array is an array of Bio::Seq objects
$blast_report = $factory-> blastpgp(\@seq_array);
Returns : Reference to a Bio::SearchIO object containing the blast report
Args : Name of a file or Bio::Seq object. In psiblast jumpstart
mode two additional arguments are required: a SimpleAlign
object one of whose elements is the query and a "mask" to
determine how BLAST should select scoring matrices see
DESCRIPTION above for more details.
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
Returns : Reference to Bio::SearchIO object containing the blast report.
rpsblast
Title : rpsblast
Usage : $blast_report = $factory->rpsblast('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"MVVLCRADDEEQQPPTCADEEQQQVVGG");
$blast_report = $factory->rpsblast($input);
or
$seq_array_ref = \@seq_array;
# where @seq_array is an array of Bio::Seq objects
$blast_report = $factory->rpsblast(\@seq_array);
Args : Name of a file or Bio::Seq object or an array of
Bio::Seq object containing the query sequence(s).
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
Returns : Reference to a Bio::SearchIO object containing the blast report
bl2seq
Title : bl2seq
Usage : $factory-> bl2seq('t/seq1.fa', 't/seq2.fa');
or
$input1 = Bio::Seq->new(-id=>"test query1",
-seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
$input2 = Bio::Seq->new(-id=>"test query2",
-seq=>"ACTADDEMMMMMMMDEEQQQVVGG");
$blast_report = $factory->bl2seq ($input1, $input2);
Returns : Reference to a BPbl2seq object containing the blast report.
Args : Names of 2 files or 2 Bio::Seq objects containing the
sequences to be aligned by bl2seq.
Throws an exception if argument is not either a pair of
strings (eg filenames) or references to Bio::Seq objects.
If arguments are strings, throws exception if files
corresponding to string names can not be found.
_generic_local_blast
Title : _generic_local_blast
Usage : internal function not called directly
Returns : Bio::SearchIO
Args : Reference to calling object and name of BLAST executable
_runblast
Title : _runblast
Usage : Internal function, not to be called directly
Function: makes actual system call to Blast program
Example :
Returns : Report Bio::SearchIO object in the appropriate format
Args : Reference to calling object, name of BLAST executable,
and parameter string for executable
_setparams
Title : _setparams
Usage : Internal function, not to be called directly
Function: Create parameter inputs for Blast program
Example :
Returns : parameter string to be passed to Blast
Args : Reference to calling object and name of BLAST executable
perl v5.14.12011-Bio::Tools::Run::StandAloneNCBIBlast(3)