faidx(5) Bioinformatics formats faidx(5)NAMEfaidx - an index enabling random access to FASTA files
SYNOPSIS
file.fa.fai, file.fasta.fai
DESCRIPTION
Using an fai index file in conjunction with a FASTA file containing
reference sequences enables efficient access to arbitrary regions
within those reference sequences. The index file typically has the
same filename as the corresponding FASTA file, with .fai appended.
An fai index file is a text file consisting of lines each with five
TAB-delimited columns:
NAME Name of this reference sequence
LENGTH Total length of this reference sequence, in bases
OFFSET Offset within the FASTA file of this sequence's first base
LINEBASES The number of bases on each line
LINEWIDTH The number of bytes in each line, including the newline
The NAME and LENGTH columns contain the same data as would appear in
the SN and LN fields of a SAM @SQ header for the same reference
sequence.
The OFFSET column contains the offset within the FASTA file, in bytes
starting from zero, of the first base of this reference sequence, i.e.,
of the character following the newline at the end of the ">" header
line. Typically the lines of a fai index file appear in the order in
which the reference sequences appear in the FASTA file, so .fai files
are typically sorted according to this column.
The LINEBASES column contains the number of bases in each of the
sequence lines that form the body of this reference sequence, apart
from the final line which may be shorter. The LINEWIDTH column con‐
tains the number of bytes in each of the sequence lines (except perhaps
the final line), thus differing from LINEBASES in that it also counts
the bytes forming the line terminator.
FASTA Files
In order to be indexed with samtools faidx, a FASTA file must be a text
file of the form
>name [description...]
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
>name [description...]
ATGCATGCATGCAT
GCATGCATGCATGC
[...]
In particular, each reference sequence must be "well-formatted", i.e.,
all of its sequence lines must be the same length, apart from the final
sequence line which may be shorter. (While this sequence line length
must be the same within each sequence, it may vary between different
reference sequences in the same FASTA file.)
This also means that although the FASTA file may have Unix- or Windows-
style or other line termination, the newline characters present must be
consistent, at least within each reference sequence.
The samtools implementation uses the first word of the ">" header line
text (i.e., up to the first whitespace character, having skipped any
initial whitespace after the ">") as the NAME column.
EXAMPLE
For example, given this FASTA file
>one
ATGCATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGCATGCATGCATGCATGC
ATGCAT
>two another chromosome
ATGCATGCATGCAT
GCATGCATGCATGC
formatted with Unix-style (LF) line termination, the corresponding fai
index would be
one 66 5 30 31
two 28 98 14 15
If the FASTA file were formatted with Windows-style (CR-LF) line termi‐
nation, the fai index would be
one 66 6 30 32
two 28 103 14 16
SEE ALSOsamtools(1)
http://en.wikipedia.org/wiki/FASTA_format
Further description of the FASTA format
htslib August 2015 faidx(5)
